Angiopoietin-1 cDNA ORF Clone, Human, N-His tag

Cat: HG13667-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Angiopoietin-1 Reagents

CRO Services

Product recommended


All Angiopoietin-1 Reagents

Angiopoietin-1 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1497 bp
Description
Full length Clone DNA of Human angiopoietin 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiopoietin-1 cDNA ORF Clone, Human, N-His tag Alternative Names

AGP1 cDNA ORF Clone, Human;AGPT cDNA ORF Clone, Human;ANG1 cDNA ORF Clone, Human

Angiopoietin-1 Background Information

Full Name
angiopoietin 1

Angiopoietin-1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Angiopoietin-1 cDNA ORF Clone in Cloning Vector, Rhesus CG90025-G
Angiopoietin-1 cDNA ORF Clone, Rhesus, untagged CG90025-UT
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90025-ACG
Angiopoietin-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90025-ACGLN
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90025-ACR
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90025-CF
Angiopoietin-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90025-NF
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-His tag CG90025-CH
Angiopoietin-1 cDNA ORF Clone, Rhesus, N-His tag CG90025-NH
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-HA tag CG90025-CY
Angiopoietin-1 cDNA ORF Clone, Rhesus, N-HA tag CG90025-NY
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-Myc tag CG90025-CM
Angiopoietin-1 cDNA ORF Clone, Rhesus, N-Myc tag CG90025-NM

Angiopoietin-1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Angiopoietin-1 cDNA ORF Clone in Cloning Vector, Mouse MG50300-M
Angiopoietin-1 cDNA ORF Clone, Mouse, untagged MG50300-UT
Angiopoietin-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50300-ACG
Angiopoietin-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50300-ACGLN
Angiopoietin-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50300-ACR
Angiopoietin-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50300-CF
Angiopoietin-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50300-NF
Angiopoietin-1 cDNA ORF Clone, Mouse, C-His tag MG50300-CH
Angiopoietin-1 cDNA ORF Clone, Mouse, N-His tag MG50300-NH
Angiopoietin-1 cDNA ORF Clone, Mouse, C-HA tag MG50300-CY
Angiopoietin-1 cDNA ORF Clone, Mouse, N-HA tag MG50300-NY
Angiopoietin-1 cDNA ORF Clone, Mouse, C-Myc tag MG50300-CM
Angiopoietin-1 cDNA ORF Clone, Mouse, N-Myc tag MG50300-NM
Angiopoietin-1 qPCR Primer Pairs, Mouse MP200323

Angiopoietin-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Angiopoietin-1 cDNA ORF Clone in Cloning Vector, Human HG13667-G
Angiopoietin-1 cDNA ORF Clone, Human, untagged HG13667-UT
Angiopoietin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16506-ACGLN
Angiopoietin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13667-ACGLN
Angiopoietin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13667-ACG
Angiopoietin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13667-ACR
Angiopoietin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13667-CF
Angiopoietin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13667-NF
Angiopoietin-1 cDNA ORF Clone, Human, C-His tag HG13667-CH
Angiopoietin-1 cDNA ORF Clone, Human, C-His tag HG16506-CH
Angiopoietin-1 cDNA ORF Clone, Human, C-HA tag HG13667-CY
Angiopoietin-1 cDNA ORF Clone, Human, N-HA tag HG13667-NY
Angiopoietin-1 cDNA ORF Clone, Human, C-Myc tag HG13667-CM
Angiopoietin-1 cDNA ORF Clone, Human, N-Myc tag HG13667-NM
Angiopoietin-1 qPCR Primer Pairs, Human HP102347
info info
添加购物车成功! 添加购物车失败!