ANKS1B cDNA ORF Clone, Human, N-His tag

Cat: HG15392-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ANKS1B Reagents
CRO Services
Product recommended

All ANKS1B Reagents
ANKS1B cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Human ankyrin repeat and sterile alpha motif domain containing 1B with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANKS1B cDNA ORF Clone, Human, N-His tag Alternative Names
AIDA cDNA ORF Clone, Human;AIDA-1 cDNA ORF Clone, Human;ANKS2 cDNA ORF Clone, Human;cajalin-2 cDNA ORF Clone, Human;EB-1 cDNA ORF Clone, Human;EB1 cDNA ORF Clone, Human
ANKS1B Background Information
Full Name
ankyrin repeat and sterile alpha motif domain containing 1B

ANKS1B cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
ANKS1B cDNA ORF Clone in Cloning Vector, Canine DG70186-U
ANKS1B cDNA ORF Clone, Canine, untagged DG70186-UT
ANKS1B cDNA ORF Clone, Canine, C-GFPSpark® tag DG70186-ACG
ANKS1B Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70186-ACGLN
ANKS1B cDNA ORF Clone, Canine, N-GFPSpark® tag DG70186-ANG
ANKS1B cDNA ORF Clone, Canine, C-OFPSpark® tag DG70186-ACR
ANKS1B cDNA ORF Clone, Canine, N-OFPSpark® tag DG70186-ANR
ANKS1B cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70186-CF
ANKS1B cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70186-NF
ANKS1B cDNA ORF Clone, Canine, C-His tag DG70186-CH
ANKS1B cDNA ORF Clone, Canine, N-His tag DG70186-NH
ANKS1B cDNA ORF Clone, Canine, C-HA tag DG70186-CY
ANKS1B cDNA ORF Clone, Canine, N-HA tag DG70186-NY
ANKS1B cDNA ORF Clone, Canine, C-Myc tag DG70186-CM
ANKS1B cDNA ORF Clone, Canine, N-Myc tag DG70186-NM

ANKS1B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANKS1B cDNA ORF Clone in Cloning Vector, Human HG15392-G
ANKS1B cDNA ORF Clone, Human, untagged HG15392-UT
ANKS1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15392-ACGLN
ANKS1B cDNA ORF Clone, Human, C-GFPSpark® tag HG15392-ACG
ANKS1B cDNA ORF Clone, Human, N-GFPSpark® tag HG15392-ANG
ANKS1B cDNA ORF Clone, Human, C-OFPSpark® tag HG15392-ACR
ANKS1B cDNA ORF Clone, Human, N-OFPSpark® tag HG15392-ANR
ANKS1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15392-CF
ANKS1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15392-NF
ANKS1B cDNA ORF Clone, Human, C-His tag HG15392-CH
ANKS1B cDNA ORF Clone, Human, C-HA tag HG15392-CY
ANKS1B cDNA ORF Clone, Human, N-HA tag HG15392-NY
ANKS1B cDNA ORF Clone, Human, C-Myc tag HG15392-CM
ANKS1B cDNA ORF Clone, Human, N-Myc tag HG15392-NM
ANKS1B qPCR Primer Pairs, Human HP104016
info info
添加购物车成功! 添加购物车失败!