After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Human ANXA6 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_005429.2
cDNA 크기:2022 bp
cDNA 설명:Full length Clone DNA of Homo sapiens annexin A6
유전자 동의어:ANX6,CBP68
:Human
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, C-HA 태그 on other vectors
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11161-ACG288840
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11161-ACR288840
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11161-ANG288840
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11161-ANR288840
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11161-CF88420
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, C-His 태그HG11161-CH253470
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11161-CM253470
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, C-HA 태그HG11161-CY253470
内参对照抗体HG11161-M88420
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11161-M-F253470
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11161-NF253470
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, N-His 태그HG11161-NH253470
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11161-NM253470
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmid, N-HA 태그HG11161-NY253470
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone in cloning vectorHG11161-U88420
휴먼 Annexin VI/ANXA6 Gene ORF cDNA clone expression plasmidHG11161-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 

참고자료
  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • Size / Price
    Cat No: HG11161-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".