After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human AP2M1 natural ORF mammalian expression plasmid

데이터시트리뷰관련제품프로토콜
Human AP2M1 cDNA 클론 제품 정보
Gene_bank_ref_id:BC004996.1
cDNA 크기:1308bp
cDNA 설명:Full length Clone DNA of Homo sapiens adaptor-related protein complex 2, mu 1 subunit.
유전자 동의어:mu2, AP50, CLAPM1
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-AP2M1
제한 사이트:HindIII + NotI (6.1kb + 1.31kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Cat No: HG16144-UT
정가:   (Save )
가격:      [How to order]
재고정보In Stock 배송안내
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".