휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, C-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 ASPH cDNA 클론 제품 정보
    Gene_bank_ref_id:BC066929
    cDNA 크기:612bp
    cDNA 설명:Full length Clone DNA of Homo sapiens aspartate beta-hydroxylase with C terminal His tag.
    유전자 동의어:AAH, BAH, HAAH, JCTN, junctin, CASQ2BP1
    :Human
    벡터:pCMV3-C-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ASPH qPCR primers for gene expression analysis, HP103780 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG15153-ACG265260
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG15153-ACR265260
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG15153-ANG265260
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG15153-ANR265260
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, C-Flag 태그HG15153-CF229890
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, C-His 태그HG15153-CH229890
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, C-Myc 태그HG15153-CM229890
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, C-HA 태그HG15153-CY229890
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone in cloning vectorHG15153-G88420
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, N-Flag 태그HG15153-NF229890
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, N-His 태그HG15153-NH229890
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, N-Myc 태그HG15153-NM229890
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmid, N-HA 태그HG15153-NY229890
    휴먼 ASPH/Aspartate beta hydroxylase Gene ORF cDNA clone expression plasmidHG15153-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    Size / Price
    Cat No: HG15153-CH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".