ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, C-His tag

Cat: HG15153-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ASPH/Aspartate beta hydroxylase Reagents

CRO Services

Product recommended


All ASPH/Aspartate beta hydroxylase Reagents

ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
612 bp
Description
Full length Clone DNA of Human aspartate beta-hydroxylase with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, C-His tag Alternative Names

AAH cDNA ORF Clone, Human;BAH cDNA ORF Clone, Human;CASQ2BP1 cDNA ORF Clone, Human;FDLAB cDNA ORF Clone, Human;HAAH cDNA ORF Clone, Human;JCTN cDNA ORF Clone, Human;junctin cDNA ORF Clone, Human

ASPH/Aspartate beta hydroxylase Background Information

Full Name
aspartate beta-hydroxylase

ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ASPH/Aspartate beta hydroxylase cDNA ORF Clone in Cloning Vector, Mouse MG58638-U
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, untagged MG58638-UT
ASPH/Aspartate beta hydroxylase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58638-ACGLN
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58638-ACG
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58638-ANG
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58638-ACR
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58638-ANR
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58638-CF
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58638-NF
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, C-His tag MG58638-CH
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, N-His tag MG58638-NH
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, C-HA tag MG58638-CY
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, N-HA tag MG58638-NY
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, C-Myc tag MG58638-CM
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Mouse, N-Myc tag MG58638-NM

ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ASPH/Aspartate beta hydroxylase cDNA ORF Clone in Cloning Vector, Human HG15153-G
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, untagged HG15153-UT
ASPH/Aspartate beta hydroxylase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15153-ACGLN
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, C-GFPSpark® tag HG15153-ACG
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, N-GFPSpark® tag HG15153-ANG
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, C-OFPSpark® tag HG15153-ACR
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, N-OFPSpark® tag HG15153-ANR
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15153-CF
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15153-NF
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, N-His tag HG15153-NH
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, C-HA tag HG15153-CY
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, N-HA tag HG15153-NY
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, C-Myc tag HG15153-CM
ASPH/Aspartate beta hydroxylase cDNA ORF Clone, Human, N-Myc tag HG15153-NM
ASPH/Aspartate beta hydroxylase qPCR Primer Pairs, Human HP103780
info info
添加购物车成功! 添加购物车失败!