Asporin/ASPN cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13308-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Asporin/ASPN Reagents

CRO Services

Product recommended


All Asporin/ASPN Reagents

Asporin/ASPN cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1140 bp
Description
Full length Clone DNA of Human asporin with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Asporin/ASPN cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

OS3 cDNA ORF Clone, Human;PLAP-1 cDNA ORF Clone, Human;PLAP1 cDNA ORF Clone, Human;SLRR1C cDNA ORF Clone, Human

Asporin/ASPN Background Information

Full Name
asporin

Asporin/ASPN cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Asporin/ASPN cDNA ORF Clone in Cloning Vector, Rat RG8A1356-U
Asporin/ASPN Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1356-ACGLN

Asporin/ASPN cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Asporin/ASPN cDNA ORF Clone in Cloning Vector, Mouse MG5A0122-U
Asporin/ASPN cDNA ORF Clone, Mouse, untagged MG5A0122-UT
Asporin/ASPN cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0122-ACG
Asporin/ASPN Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0122-ACGLN
Asporin/ASPN cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0122-ACR
Asporin/ASPN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0122-CF
Asporin/ASPN cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0122-NF
Asporin/ASPN cDNA ORF Clone, Mouse, C-His tag MG5A0122-CH
Asporin/ASPN cDNA ORF Clone, Mouse, N-His tag MG5A0122-NH
Asporin/ASPN cDNA ORF Clone, Mouse, C-HA tag MG5A0122-CY
Asporin/ASPN cDNA ORF Clone, Mouse, N-HA tag MG5A0122-NY
Asporin/ASPN cDNA ORF Clone, Mouse, C-Myc tag MG5A0122-CM
Asporin/ASPN cDNA ORF Clone, Mouse, N-Myc tag MG5A0122-NM

Asporin/ASPN cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Asporin/ASPN cDNA ORF Clone in Cloning Vector, Human HG13308-G
Asporin/ASPN cDNA ORF Clone, Human, untagged HG13308-UT
Asporin/ASPN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13308-ACGLN
Asporin/ASPN cDNA ORF Clone, Human, C-GFPSpark® tag HG13308-ACG
Asporin/ASPN cDNA ORF Clone, Human, C-OFPSpark® tag HG13308-ACR
Asporin/ASPN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13308-NF
Asporin/ASPN cDNA ORF Clone, Human, C-His tag HG13308-CH
Asporin/ASPN cDNA ORF Clone, Human, N-His tag HG13308-NH
Asporin/ASPN cDNA ORF Clone, Human, C-HA tag HG13308-CY
Asporin/ASPN cDNA ORF Clone, Human, N-HA tag HG13308-NY
Asporin/ASPN cDNA ORF Clone, Human, C-Myc tag HG13308-CM
Asporin/ASPN cDNA ORF Clone, Human, N-Myc tag HG13308-NM
Asporin/ASPN qPCR Primer Pairs, Human HP102014
info info
添加购物车成功! 添加购物车失败!