ATG12 cDNA ORF Clone, Human, C-His tag

Cat: HG11111-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ATG12 Reagents

CRO Services

Product recommended


All ATG12 Reagents

ATG12 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
564 bp
Description
Full length Clone DNA of Human ATG12 autophagy related 12 homolog (S. cerevisiae) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATG12 cDNA ORF Clone, Human, C-His tag Alternative Names

APG12 cDNA ORF Clone, Human;APG12L cDNA ORF Clone, Human;FBR93 cDNA ORF Clone, Human;HAPG12 cDNA ORF Clone, Human

ATG12 Background Information

Full Name
autophagy related 12

ATG12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATG12 cDNA ORF Clone in Cloning Vector, Mouse MG5A0758-U
ATG12 cDNA ORF Clone, Mouse, untagged MG5A0758-UT
ATG12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0758-ACG
ATG12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0758-ACGLN
ATG12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0758-ANG
ATG12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0758-ACR
ATG12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0758-ANR
ATG12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0758-CF
ATG12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0758-NF
ATG12 cDNA ORF Clone, Mouse, C-His tag MG5A0758-CH
ATG12 cDNA ORF Clone, Mouse, N-His tag MG5A0758-NH
ATG12 cDNA ORF Clone, Mouse, C-HA tag MG5A0758-CY
ATG12 cDNA ORF Clone, Mouse, N-HA tag MG5A0758-NY
ATG12 cDNA ORF Clone, Mouse, C-Myc tag MG5A0758-CM
ATG12 cDNA ORF Clone, Mouse, N-Myc tag MG5A0758-NM

ATG12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATG12 cDNA ORF Clone in Cloning Vector, Human HG11111-M
ATG12 cDNA ORF Clone, Human, untagged HG11111-UT
ATG12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11111-ACGLN
ATG12 cDNA ORF Clone, Human, C-GFPSpark® tag HG11111-ACG
ATG12 cDNA ORF Clone, Human, N-GFPSpark® tag HG11111-ANG
ATG12 cDNA ORF Clone, Human, C-OFPSpark® tag HG11111-ACR
ATG12 cDNA ORF Clone, Human, N-OFPSpark® tag HG11111-ANR
ATG12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11111-CF
ATG12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11111-NF
ATG12 cDNA ORF Clone, Human, N-His tag HG11111-NH
ATG12 cDNA ORF Clone, Human, C-HA tag HG11111-CY
ATG12 cDNA ORF Clone, Human, N-HA tag HG11111-NY
ATG12 cDNA ORF Clone, Human, C-Myc tag HG11111-CM
ATG12 cDNA ORF Clone, Human, N-Myc tag HG11111-NM
ATG12 qPCR Primer Pairs, Human HP101026
info info
添加购物车成功! 添加购物车失败!