휴먼 ATP1B1 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    휴먼 ATP1B1 cDNA 클론 제품 정보
    Gene_bank_ref_id:BC000006
    cDNA 크기:912bp
    cDNA 설명:Full length Clone DNA of Homo sapiens ATPase, NA+/K+ transporting, beta 1 polypeptide.
    유전자 동의어:ATP1B, MGC1798, ATP1B1
    :Human
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ATP1B1 qPCR primers for gene expression analysis, HP102905 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    연구배경

    ATP1B1 belongs to the family of Na+/K+ and H+/K+-ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. ATP1B1 is a subunit of Na+/K+-ATPase. Na+/K+-ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. Na+/K+-ATPase is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). ATP1B1 regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. ATP1B1 is the non-catalytic component of the active enzyme, which catalyzes the hydrolysis of ATP coupled with which catalyzes the hydrolysis of ATP coupled with the exchange of Na+ and K+ ions across the plasma membrane.

    참고자료
  • Lingrel JB. et al., 1990, Prog Nucleic Acid Res Mol Biol. 38: 37-89.
  • Oakey RJ. et al., 1993, Hum Mol Genet. 1 (8): 613-20.
  • Ushkaryov YuA. et al., 1990, FEBS Lett. 257 (2): 439-42.
  • Size / Price
    Cat No: HG14255-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".