After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 Azurocidin / CAP37 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human AZU1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001700.3
cDNA 크기:756bp
cDNA 설명:Full length Clone DNA of Homo sapiens azurocidin 1.
유전자 동의어:AZU, HBP, NAZC, AZAMP, CAP37, HUMAZUR, AZU1
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-AZU1
제한 사이트:KpnI + XbaI (6.1kb + 0.76kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 165C>A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human AZU1 Gene Plasmid Map
Human AZU1 / HBP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
연구배경

Azurocidin (AZU1), also known as heparin-binding protein (HBP) or cationic antimicrobial protein 37 (CAP37), is an azurophil granule antibiotic protein, with monocyte chemotactic and antibacterial activity. The Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. Azurocidin is a member of the serine protease family that includes Cathepsin G, neutrophil elastase (NE), and proteinase 3 (PR3), however, Azurocidin is not a serine proteinase since the active site serine and histidine residues are replaced. Neutrophils arriving first at sites of inflammation release Azurocidin, which acts in a paracrine fashion on endothelial cells causing the development of intercellular gaps and allowing leukocyte extravasation. It thus be regarded as a reasonable therapeutic target for a variety of inflammatory disease conditions.

참고자료
  • Lindmark A, et al. (1999) Characterization of the biosynthesis, processing, and sorting of human HBP/CAP37/azurocidin. J Leukoc Biol. 66(4): 634-43.
  • Heinzelmann M, et al. (2001) Heparin binding protein (CAP37) differentially modulates endotoxin-induced cytokine production. Int J Surg Investig. 2(6): 457-66.
  • Soehnlein O, et al. (2005) Neutrophil-derived heparin-binding protein (HBP/CAP37) deposited on endothelium enhances monocyte arrest under flow conditions. J Immunol. 174(10): 6399-405.
  • Size / Price
    Cat No: HG10660-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human AZU1 / HBP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".