After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human ANGPTL4 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_139314.1
cDNA 크기:1221bp
cDNA 설명:Full length Clone DNA of Homo sapiens angiopoietin-like 4, transcript variant 1 with N terminal Flag tag.
유전자 동의어:NL2, ARP4, FIAF, PGAR, HFARP, pp1158, ANGPTL2
:Human
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10563-ACG265260
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10563-ACR265260
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10563-CF229890
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG10563-CH229890
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10563-CM229890
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10563-CY229890
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10563-M88420
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10563-M-F229890
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10563-NF229890
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG10563-NH229890
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10563-NM229890
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10563-NY229890
휴먼 ANGPTL4 / angiopoietin-like 단백질 4 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10563-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

참고자료
  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Cat No: HG10563-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".