휴먼 B4GALT1/GGTB2 Gene ORF cDNA clone expression plasmid, N-Flag 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 B4GALT1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001497.3
    cDNA 크기:1197bp
    cDNA 설명:Full length Clone DNA of Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 with N terminal Flag tag.
    유전자 동의어:GT1, GTB, GGTB2, B4GAL-T1, MGC50983, beta4Gal-T1, DKFZp686N19253, B4GALT1
    :Human
    벡터:pCMV3-SP-N-FLAG
    Plasmid:
    제한 사이트:
    태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with B4GALT1 qPCR primers for gene expression analysis, HP101121 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    연구배경

    Beta1,4-Galactosyltransferase-I (B4GALT1), one of seven beta1,4-galactosyltransferases, is an enzyme commonly found in the trans-Golgi complex that adds galactose to oligosaccharides. They have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. B4GALT1 gene directs production of B4GALT1 protein using either of two transcription start sites. The product of the smaller transcript serves the traditional biosynthetic role in the Golgi. This form also complexes with α-lactalbumin, a mammary-specific protein, to form lactose synthase. In addition to a biosynthetic role, the protein translated from the longer transcript appears on the plasma membranes of some cells where it serves as a signalling receptor in cell-matrix interactions such as sperm-egg binding.

    참고자료
  • Hennet T. (2002) The galactosyltransferase family. Cellular and Molecular Life Sciences. 59(7): 1081-95.
  • Landers EA, et al. (2009) Porcine 1, 4-Galactosyltransferase-I Sequence and Expression. Reproduction in Domestic Animals. 44(2): 228-34.
  • Amado M, et al. (2000) Identification and characterization of large galactosyltransferase gene families: galactosyltransferases for all functions. Biochim Biophys Acta. 1473 (1): 35-53.
  • Size / Price
    Cat No: HG11220-NF
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".