After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 BCL6 Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Human BCL6 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_138931
cDNA 크기:2121bp
cDNA 설명:Full length Clone DNA of Homo sapiens B-cell CLL/lymphoma 6 with C terminal HA tag.
유전자 동의어:ZBTB27, LAZ3, BCL5, BCL6A
:Human
벡터:pCMV3-C-HA
Plasmid:pCMV3-BCL6-HA
제한 사이트:KpnI + NotI (6kb + 2.16kb)
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human BCL6 Gene Plasmid Map
Human BCL6 ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

The protein encoded by this gene is an evolutionarily conserved 95-kDa protein containing six C-terminal zinc-finger motifs and an N-terminal POZ domain. It has been reported that BCL-6 is present in DNA-binding complexes in nuclear extracts from various B-cell lines. There are many relationships between non-Hodgkin's lymphoma, diffuse large cell lymphoma and BCL6’s translocations. BCL6 can repress transcription from promoters linked to its DNA target sequence and this activity is dependent upon specific DNA-binding and the presence of an intact N-terminal half of the protein.

참고자료
  • Ye BH, et al. (1997) The BCL-6 proto-oncogene controls germinal-centre formation and Th2-type inflammation. Nature Genetics. 16: 161-70.
  • Seyfert VL, et al. (1996) Transcriptional repression by the proto-oncogene BCL-6. Oncogene. 12 (11) : 2331-42.
  • Chang CC, et al. (1996) BCL-6, a POZ/zinc-finger protein, is a sequence-specific transcriptional repressor. PNAS. 93 (14): 6947-52.
  • Size / Price
    Cat No: HG12083-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human BCL6 ORF mammalian expression plasmid, C-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".