BDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13354-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All BDH2 Reagents

CRO Services

Product recommended


All BDH2 Reagents

BDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Human 3-hydroxybutyrate dehydrogenase, type 2 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

DHRS6 cDNA ORF Clone, Human;EFA6R cDNA ORF Clone, Human;PRO20933 cDNA ORF Clone, Human;SDR15C1 cDNA ORF Clone, Human;UCPA-OR cDNA ORF Clone, Human;UNQ6308 cDNA ORF Clone, Human

BDH2 Background Information

Full Name
3-hydroxybutyrate dehydrogenase, type 2

BDH2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BDH2 cDNA ORF Clone in Cloning Vector, Mouse MG53384-U
BDH2 cDNA ORF Clone, Mouse, untagged MG53384-UT
BDH2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53384-ACGLN
BDH2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53384-ACG
BDH2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53384-ANG
BDH2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53384-ACR
BDH2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53384-ANR
BDH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53384-CF
BDH2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53384-NF
BDH2 cDNA ORF Clone, Mouse, C-His tag MG53384-CH
BDH2 cDNA ORF Clone, Mouse, N-His tag MG53384-NH
BDH2 cDNA ORF Clone, Mouse, C-HA tag MG53384-CY
BDH2 cDNA ORF Clone, Mouse, N-HA tag MG53384-NY
BDH2 cDNA ORF Clone, Mouse, C-Myc tag MG53384-CM
BDH2 cDNA ORF Clone, Mouse, N-Myc tag MG53384-NM

BDH2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BDH2 cDNA ORF Clone in Cloning Vector, Human HG13354-G
BDH2 cDNA ORF Clone, Human, untagged HG13354-UT
BDH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13354-ACGLN
BDH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13354-ACG
BDH2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13354-ANG
BDH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13354-ACR
BDH2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13354-ANR
BDH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13354-CF
BDH2 cDNA ORF Clone, Human, C-His tag HG13354-CH
BDH2 cDNA ORF Clone, Human, N-His tag HG13354-NH
BDH2 cDNA ORF Clone, Human, C-HA tag HG13354-CY
BDH2 cDNA ORF Clone, Human, N-HA tag HG13354-NY
BDH2 cDNA ORF Clone, Human, C-Myc tag HG13354-CM
BDH2 cDNA ORF Clone, Human, N-Myc tag HG13354-NM
BDH2 qPCR Primer Pairs, Human HP102058
info info
添加购物车成功! 添加购物车失败!