SHARP2/BHLHE40 cDNA ORF Clone, Human, N-Myc tag

Cat: HG15466-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SHARP2/BHLHE40 Reagents
CRO Services
Product recommended

All SHARP2/BHLHE40 Reagents
SHARP2/BHLHE40 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Description
Full length Clone DNA of Human basic helix-loop-helix family, member e40 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SHARP2/BHLHE40 cDNA ORF Clone, Human, N-Myc tag Alternative Names
42339 cDNA ORF Clone, Human;BHLHB2 cDNA ORF Clone, Human;HLHB2 cDNA ORF Clone, Human;SHARP-2 cDNA ORF Clone, Human;STRA13 cDNA ORF Clone, Human;Stra14 cDNA ORF Clone, Human
SHARP2/BHLHE40 Background Information
Full Name
basic helix-loop-helix family, member e40

SHARP2/BHLHE40 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SHARP2/BHLHE40 cDNA ORF Clone in Cloning Vector, Mouse MG58191-U
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, untagged MG58191-UT
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58191-ACG
SHARP2/BHLHE40 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58191-ACGLN
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58191-ANG
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58191-ACR
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58191-ANR
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58191-CF
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58191-NF
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, C-His tag MG58191-CH
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, N-His tag MG58191-NH
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, C-HA tag MG58191-CY
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, N-HA tag MG58191-NY
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, C-Myc tag MG58191-CM
SHARP2/BHLHE40 cDNA ORF Clone, Mouse, N-Myc tag MG58191-NM

SHARP2/BHLHE40 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SHARP2/BHLHE40 cDNA ORF Clone in Cloning Vector, Human HG15466-G
SHARP2/BHLHE40 cDNA ORF Clone, Human, untagged HG15466-UT
SHARP2/BHLHE40 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15466-ACGLN
SHARP2/BHLHE40 cDNA ORF Clone, Human, C-GFPSpark® tag HG15466-ACG
SHARP2/BHLHE40 cDNA ORF Clone, Human, N-GFPSpark® tag HG15466-ANG
SHARP2/BHLHE40 cDNA ORF Clone, Human, C-OFPSpark® tag HG15466-ACR
SHARP2/BHLHE40 cDNA ORF Clone, Human, N-OFPSpark® tag HG15466-ANR
SHARP2/BHLHE40 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15466-CF
SHARP2/BHLHE40 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15466-NF
SHARP2/BHLHE40 cDNA ORF Clone, Human, C-His tag HG15466-CH
SHARP2/BHLHE40 cDNA ORF Clone, Human, N-His tag HG15466-NH
SHARP2/BHLHE40 cDNA ORF Clone, Human, C-HA tag HG15466-CY
SHARP2/BHLHE40 cDNA ORF Clone, Human, N-HA tag HG15466-NY
SHARP2/BHLHE40 cDNA ORF Clone, Human, C-Myc tag HG15466-CM
SHARP2/BHLHE40 qPCR Primer Pairs, Human HP104089
info info
添加购物车成功! 添加购物车失败!