cIAP2/BIRC3 cDNA ORF Clone, Human, N-GFPSpark® tag

Price:
Size:
Number:

cIAP2/BIRC3 cDNA ORF Clone, Human, N-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1815 bp
Description
Full length Clone DNA of Human baculoviral IAP repeat-containing 3 with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

cIAP2/BIRC3 cDNA ORF Clone, Human, N-GFPSpark® tag: Alternative Names

AIP1 cDNA ORF Clone, Human; API2 cDNA ORF Clone, Human; c-IAP2 cDNA ORF Clone, Human; CIAP2 cDNA ORF Clone, Human; HAIP1 cDNA ORF Clone, Human; HIAP1 cDNA ORF Clone, Human; MALT2 cDNA ORF Clone, Human; MIHC cDNA ORF Clone, Human; RNF49 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait