Survivin cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10356-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Survivin Reagents
CRO Services
Product recommended

All Survivin Reagents
Survivin cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
429 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human baculoviral IAP repeat-containing 5, transcript variant 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.47kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Survivin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Survivin cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human Survivin/BIRC5/API4 Gene Expression validated Image 14303
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Survivin cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
API4 cDNA ORF Clone, Human;BIRC5 cDNA ORF Clone, Human;EPR-1 cDNA ORF Clone, Human;IAP4 cDNA ORF Clone, Human
Survivin Background Information

BIRC5, also known as Survivin and EPR-1, is a member of the IAP family. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but BIRC5 has only a single BIR domain. It is expressed cell cycle-dependently and highly expressed at mitosis. As a multitasking protein, BIRC5 has dual roles in promoting cell proliferation and preventing apoptosis. Survivin is a component of a chromosome passage protein complex (CPC) which is essential for chromosome alignment and segregation during mitosis and cytokinesis. Survivin acts as an important regulator of the localization of this complex. It may counteract a default induction of apoptosis in G2/M phase.

Full Name
baculoviral IAP repeat containing 5
References
  • Altieri DC. 1994, J Biol Chem. 269 (5): 3139-42.
  • Bouchard BA. et al., 2002, Thromb Haemost. 86 (4): 1133-5.
  • Yao XQ. et al., 2004, World J Gastroenterol. 10 (9): 1262-7.
  • Survivin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Survivin cDNA ORF Clone in Cloning Vector, Rat RG81966-U
    Survivin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81966-ACGLN

    Survivin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Survivin cDNA ORF Clone in Cloning Vector, Mouse MG57331-U
    Survivin cDNA ORF Clone, Mouse, untagged MG57331-UT
    Survivin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57331-ACGLN
    Survivin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57331-ACG
    Survivin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57331-ANG
    Survivin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57331-ACR
    Survivin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57331-ANR
    Survivin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57331-CF
    Survivin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57331-NF
    Survivin cDNA ORF Clone, Mouse, C-His tag MG57331-CH
    Survivin cDNA ORF Clone, Mouse, N-His tag MG57331-NH
    Survivin cDNA ORF Clone, Mouse, C-HA tag MG57331-CY
    Survivin cDNA ORF Clone, Mouse, N-HA tag MG57331-NY
    Survivin cDNA ORF Clone, Mouse, C-Myc tag MG57331-CM
    Survivin cDNA ORF Clone, Mouse, N-Myc tag MG57331-NM

    Survivin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Survivin cDNA ORF Clone in Cloning Vector, Human HG10356-M
    Survivin cDNA ORF Clone, Human, untagged HG10356-UT
    Survivin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10356-ACGLN
    Survivin cDNA ORF Clone, Human, C-GFPSpark® tag HG10356-ACG
    Survivin cDNA ORF Clone, Human, N-GFPSpark® tag HG10356-ANG
    Survivin cDNA ORF Clone, Human, C-OFPSpark® tag HG10356-ACR
    Survivin cDNA ORF Clone, Human, N-OFPSpark® tag HG10356-ANR
    Survivin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10356-NF
    Survivin cDNA ORF Clone, Human, C-His tag HG10356-CH
    Survivin cDNA ORF Clone, Human, N-His tag HG10356-NH
    Survivin cDNA ORF Clone, Human, C-HA tag HG10356-CY
    Survivin cDNA ORF Clone, Human, N-HA tag HG10356-NY
    Survivin cDNA ORF Clone, Human, C-Myc tag HG10356-CM
    Survivin cDNA ORF Clone, Human, N-Myc tag HG10356-NM
    Survivin qPCR Primer Pairs, Human HP100392
    info info
    添加购物车成功! 添加购物车失败!