After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human BMX cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001721.6
cDNA 크기:2028bp
cDNA 설명:Full length Clone DNA of Homo sapiens BMX non-receptor tyrosine kinase transcript variant 2 with N terminal His tag.
유전자 동의어:ETK, PSCTK2, PSCTK3, BMX
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11394-ACG288840
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11394-ACR288840
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11394-ANG288840
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11394-ANR288840
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11394-CF253470
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His 태그HG11394-CH253470
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11394-CM253470
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA 태그HG11394-CY253470
휴먼 BMX transcript variant 2 Gene ORF cDNA clone in cloning vectorHG11394-M88420
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11394-M-F253470
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11394-NF253470
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그HG11394-NH253470
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11394-NM253470
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA 태그HG11394-NY253470
휴먼 BMX transcript variant 2 Gene ORF cDNA clone expression plasmidHG11394-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: HG11394-NH
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".