After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Human CA2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000067.2
cDNA 크기:783bp
cDNA 설명:Full length Clone DNA of Homo sapiens carbonic anhydrase II with C terminal HA tag.
유전자 동의어:CAII, Car2, CA-II, CA2
:Human
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-HA 태그 on other vectors
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10478-ACG265262
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10478-ACR265262
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10478-ANG265262
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10478-ANR265262
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10478-CF229893
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-His 태그HG10478-CH229893
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10478-CM229893
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10478-CM229893
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-HA 태그HG10478-CY229893
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone in cloning vectorHG10478-M88421
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10478-NF229893
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-His 태그HG10478-NH229893
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10478-NM229893
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-HA 태그HG10478-NY229893
휴먼 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmidHG10478-UT229893
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

참고자료
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Cat No: HG10478-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".