휴먼 Carbonic Anhydrase III Gene ORF cDNA clone expression plasmid, N-HA 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 CA3 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_005181.3
    cDNA 크기:783bp
    cDNA 설명:Full length Clone DNA of Homo sapiens carbonic anhydrase III, muscle specific with N terminal HA tag.
    유전자 동의어:Car3, CAIII
    :Human
    벡터:pCMV3-N-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CA3 qPCR primers for gene expression analysis, HP100524 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    휴먼 Carbonic Anhydrase III Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
    Product nameProduct name
    연구배경

    Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Carbonic anhydrases (CAs) form a family of enzymes that catalyze the rapid conversion of carbon dioxide and water to bicarbonate and protons, a reaction that occurs rather slowly in the absence of a catalyst. The active site of most carbonic anhydrases contains a zinc ion, they are therefore classified as metalloenzymes. Several forms of carbonic anhydrase occur in nature. The primary function of the enzyme in animals is to interconvert carbon dioxide and bicarbonate to maintain acid-base balance in blood and other tissues, and to help transport carbon dioxide out of tissues. Plants contain a different form called β-carbonic anhydrase, which, from an evolutionary standpoint, is a distinct enzyme, but participates in the same reaction and also uses a zinc ion in its active site.

    Carbonic anhydrase 3, also known as Carbonate dehydratase III, CA-III and CA3, is a cytoplasm protein which belongs to the alpha-carbonic anhydrase family. CA3 is activated by proton donors such as imidazole and the dipeptide histidylhistidine. It is inhibited by coumarins and sulfonamide derivatives such as acetazolamide. At 6 weeks gestation, transcripts accumulate at low levels in the somites and at high levels throughout the notochord. As gestation continues, CA3 becomes abundant in all developing muscle masses and continues at high to moderate levels in the notochord.

    참고자료
  • Ivanov, S.V. et al., 1998, Proc. Natl. Acad. Sci. USA 95:12596-601.
  • Sowden J. et al., 1998, Gene 214:157- 65.
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899-903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40: 257-62.
  • Bataller,L. et al., 2004, Ann Neurol  56 (4): 575-9.
  • Size / Price
    Cat No: HG10503-NY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".