After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human CA13 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_198584.2
cDNA 크기:789bp
cDNA 설명:Full length Clone DNA of Homo sapiens carbonic anhydrase XIII with C terminal His tag.
유전자 동의어:CAXIII, FLJ37995, MGC59868, CA13
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10461-ACG265260
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10461-ACR265260
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10461-ANG265260
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10461-ANR265260
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10461-CF229890
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-His 태그HG10461-CH229890
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10461-CM229890
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10461-CY229890
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone in cloning vectorHG10461-M88420
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10461-M-F229890
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10461-NF229890
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-His 태그HG10461-NH229890
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10461-NM229890
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10461-NY229890
휴먼 Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmidHG10461-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. The CAXIII is a member of the CA family, which owns a globular molecule with high structural similarity to cytosolic isozymes, CAI, II, and III. Recombinant mouse CAXIII showed catalytic activity similar to those of mitochondrial CAV and cytosolic CAI. In human tissues, CAXIII expression was identified in the thymus, small intestine, spleen, prostate, ovary, colon, and testis. In mouse, positive tissues included the spleen, lung, kidney, heart, brain, skeletal muscle, and testis. In conclusion, the predicted amino acid sequence, structural model, distribution, and activity data suggest that CAXIII represents a novel enzyme, which may play important physiological roles in several organs.

참고자료
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Size / Price
    Cat No: HG10461-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".