After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Carbonic Anhydrase XIV Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human CA14 cDNA 클론 제품 정보
Gene_bank_ref_id:XM_005245060.1
cDNA 크기:960bp
cDNA 설명:Full length Clone DNA of Homo sapiens carbonic anhydrase XIV with C terminal His tag.
유전자 동의어:CAXiV
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. CAXIV is a member of CA family that showed an overall similarity of 29–46% to other active CA isozymes. The highest percentage similarity was with a transmembrane CA isoform, CAXII. The CAXIV was found high concentrations in human heart, brain, liver, and skeletal muscle but lower in the colon, small intestine, urinary bladder, and kidney. No CAXIV mRNA was seen in the salivary gland and pancreas. CAXIV is a likely candidate for the extracellular CA postulated to have an important role in modulating excitatory synaptic transmission in brain.

참고자료
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Parkkila S, et al. (2001) Expression of membrane-associated carbonic anhydrase XIV on neurons and axons in mouse and human brain. PNAS. 98(4): 1918-23.
  • Size / Price
    Cat No: HG10458-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".