After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Human CA5A cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001739.1
cDNA 크기:918bp
cDNA 설명:Full length Clone DNA of Homo sapiens carbonic anhydrase VA, mitochondrial with N terminal HA tag.
유전자 동의어:CA5, CAV, CAVA
:Human
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10500-ACG265260
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10500-ACR265260
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10500-ANG265260
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10500-ANR265260
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10500-CF229890
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, C-His 태그HG10500-CH229890
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10500-CM229890
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, C-HA 태그HG10500-CY229890
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone in cloning vectorHG10500-M88420
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10500-NF229890
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, N-His 태그HG10500-NH229890
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10500-NM229890
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmid, N-HA 태그HG10500-NY229890
휴먼 Carbonic Anhydrase VA/CA5A Gene ORF cDNA clone expression plasmidHG10500-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Carbonic anhydrase 5A, mitochondrial, also known as Carbonate dehydratase VA, Carbonic anhydrase VA, CA-VA and CA5A, is a member of the alpha-carbonic anhydrase family. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt).

참고자료
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Temperini C.et al., 2006, Chemistry 12: 7057-66.
  • Temperini C.et al., 2006, J. Med. Chem. 49: 3019-27.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".