After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CALCB / CGPR / Calcitonin 2 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human CALCB cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000728.3
cDNA 크기:384bp
cDNA 설명:Full length Clone DNA of Homo sapiens calcitonin-related polypeptide beta.
유전자 동의어:CALC2, CGRP2, CGRP-II, CALCB
:Human
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

CALCB, also known as CGPR and calcitonin 2, belongs to the calcitonin family. CALCB is a calcitonin (CT) peptide which may play a role in the mediation of human inflammatory diseases. It is highly expressed in the skin, blood, and cerebrospinal fluid. CGRP immunolabeling (IL) was detected in epidermal keratinocytes at levels that were especially high and widespread in the skin of humans from locations afflicted with postherpetic neuralgia (PHN) and complex region pain syndrome type 1 (CRPS), of monkeys infected with simian immunodeficiency virus, and of rats subjected to L5/L6 spinal nerve ligation, sciatic nerve chronic constriction, and subcutaneous injection of complete Freund's adjuvant. Increased CGRP-IL was also detected in epidermal keratinocytes of transgenic mice with keratin-14 promoter driven overexpression of noggin, an antagonist to BMP-4 signaling. CGPR dilates a variety of vessels including the coronary, cerebral and systemic vasculature.

참고자료
  • Lambert NA. 2008, Sci Signal. 1 (25): re5.
  • Linscheid P. et al., 2005, Endocrinology. 146 (6): 2699-708.
  • Hou Q. et al., 2011, Pain. 152 (9): 2036-51.
  • Size / Price
    Cat No: HG13283-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보4-5 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".