After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human CAMK2G cDNA 클론 제품 정보
Gene_bank_ref_id:NM_172170.3
cDNA 크기:1557bp
cDNA 설명:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase II gamma, transcript variant 3 with C terminal His tag.
유전자 동의어:CAMK, CAMKG, CAMK-II, FLJ16043, MGC26678, CAMK2G
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11125-ACG288840
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11125-ACR288840
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11125-ANG288840
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11125-ANR288840
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11125-CF253470
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His 태그HG11125-CH253470
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11125-CM253470
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-HA 태그HG11125-CY253470
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone in cloning vectorHG11125-M88420
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11125-M-F253470
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11125-NF253470
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His 태그HG11125-NH253470
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11125-NM253470
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA 태그HG11125-NY253470
휴먼 CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmidHG11125-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: HG11125-CH
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".