After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CAPG / AFCP Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human CAPG cDNA 클론 제품 정보
Gene_bank_ref_id:BC014549
cDNA 크기:1047bp
cDNA 설명:Full length Clone DNA of Homo sapiens capping protein (actin filament), gelsolin-like.
유전자 동의어:AFCP, MCP, CAPG
:Human
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

CAPG, also known as actin Regulatory Protein CAPG, is a a member of the gelsolin/villin family. Members of this family are actin-regulatory proteins. CAPG reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, CAPG contributes to the control of actin-based motility in non-muscle cells. CAPG may also play an important role in macrophage function.

참고자료
  • Watari A. et al., 2007, Oncogene. 25 (56): 7373-80.
  • De Corte V. et al., 2005, J Cell Sci. 117 (22): 5283-92.
  • Van Impe K. et al., 2003, J Biol Chem. 278 (20): 17945-52.
  • Size / Price
    Cat No: HG14213-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".