After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CAT/Catalase Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human CAT cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001752.3
cDNA 크기:1584bp
cDNA 설명:Full length Clone DNA of Homo sapiens catalase with N terminal Flag tag.
유전자 동의어:MGC138422, MGC138424, CAT
:Human
벡터:pCMV3-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1206C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a tetramer of four polypeptides chains containing four porphyrin heme groups that allow the enzyme to react with the hydrogen peroxide. The optimum PH of human catalase is approximately 7 and the optimum temperature is at 37 degree. Both the PH optimum and temperature for other catalases varies depending on the species. Catalase can be inhibited by a flux of O2- generated in situ by the aerobic xanthine oxidase reaction. This inhibition of catalase by O2- provides the basis for a synergism between superoxide dismutase and catalase.Such synergisms have been observed in vitro and may be significant in vivo. Catalase is used in the food industry for removing hydrogen peroxide from milk prior to cheese production. Another use is in food wrappers where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free.

참고자료
  • Schriner SE. et al., 2005, Science. 308 (5730): 1909-11.
  • Kono Y. et al., 1982, The Journal of Biological Chemistry. 257: 5751-4.
  • Size / Price
    Cat No: HG12084-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".