휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
휴먼 CBR3 cDNA 클론 제품 정보
Gene_bank_ref_id:BC002812
cDNA 크기:834bp
cDNA 설명:Full length Clone DNA of Homo sapiens carbonyl reductase 3 with N terminal HA tag.
유전자 동의어:hCBR3, SDR21C2
:Human
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CBR3 qPCR primers for gene expression analysis, HP103266 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG14632-ACG265260
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG14632-ACR265260
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG14632-ANG265260
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG14632-ANR265260
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG14632-CF229890
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-His 태그HG14632-CH229890
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG14632-CM229890
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-HA 태그HG14632-CY229890
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone in cloning vectorHG14632-G88420
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG14632-NF229890
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-His 태그HG14632-NH229890
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG14632-NM229890
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-HA 태그HG14632-NY229890
휴먼 CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmidHG14632-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

CBR3, also known as hCBR3, belongs to the short-chain dehydrogenases/reductases (SDR) family. CBR3 is expressed in ovary, pancreas, intestine, colon, kidney, brain, thymus, lung, heart, liver, spleen, leukocyte, prostate and testis. It is a monomeric NADPH-dependent oxidoreductase and is closely linked to another carbonyl reductase gene – CBR1. CBR3 catalyzes the reduction of a large number of biologically and pharmacologically active carbonyl compounds to their corresponding alcohols. It has low NADPH-dependent oxidoreductase activity towards 4-benzoylpyridine and menadione (in vitro).

참고자료
  • Lakhman SS. et al., 2005. Drug Metab Dispos. 33 (2): 254-7.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Size / Price
    Cat No: HG14632-NY
    정가: 
    가격:      (You Save: )
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".