휴먼 CCL21/6Ckine Gene ORF cDNA clone expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 CCL21 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_002989.2
    cDNA 크기:405bp
    cDNA 설명:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 21 with C terminal HA tag.
    유전자 동의어:ECL, SLC, CKb9, TCA4, 6Ckine, SCYA21, MGC34555, CCL21
    :Human
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CCL21 qPCR primers for gene expression analysis, HP100499 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    연구배경

    Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 21(CCL21), also known as 6Ckine, exodus-2, and secondary lymphoid-tissue chemokine(SLC), is a small cytokine belonging to the C-C chemokine family. CCL21 takes its name 6Ckine for its consititutively six conserved cysteine residues but not four cysteines typical to chemokines. CCL21 has function in ininducing vigorous calcium migrations and chemotactic responses.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    참고자료
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Yoshida R, et al. (1998) Secondary lymphoid-tissue chemokine is a functional ligand for the CC chemokine receptor CCR7. The journal of biological chemistry. 273: 7118-22.
  • Size / Price
    Cat No: HG10477-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".