휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human VCAM1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001078.2
cDNA 크기:2220bp
cDNA 설명:Full length Clone DNA of Homo sapiens vascular cell adhesion molecule 1, transcript variant 1 with N terminal His tag.
유전자 동의어:VCAM1, CD106, MGC99561, INCAM-100, DKFZp779G2333
:Human
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10113-ACG288840
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10113-ACR288840
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10113-CF253470
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG10113-CH253470
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10113-CM253470
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10113-CY253470
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10113-M88420
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10113-M-N253470
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10113-NF253470
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG10113-NH253470
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10113-NM253470
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10113-NY253470
휴먼 VCAM1/VCAM-1/CD106 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10113-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

참고자료
  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • Size / Price
    Cat No: HG10113-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".