After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CLM-9 / TREM4 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human CD300LG cDNA 클론 제품 정보
Gene_bank_ref_id:BC025395
cDNA 크기:999bp
cDNA 설명:Full length Clone DNA of Homo sapiens CD300 molecule-like family member g with N terminal Flag tag.
유전자 동의어:CLM9, CLM-9, TREM4, TREM-4, NEPMUCIN, CD300LG
:Human
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

CLM-9, also known as TREM4, is a receptor which belongs to the TREM family. The TREM family of receptors regulates the activity of various cell types of the immune system including neutrophils, monocyte/macrophages, microglia, and dendritic cells. CLM-9 may mediate L-selectin-dependent lymphocyte rollings. It binds SELL in a calcium dependent manner. CLM-9 also binds lymphocyte which suggests that it functions in lymphocyte adhesion. The major CLM-9 transcript is expressed highly in human heart, skeletal muscle, and placenta. The mouse protein has been shown to be expressed in capillary endothelial cells. Human CLM-9 mediates the uptake of human IgA2 and mouse IgM.

참고자료
  • Clark GJ, et al. (2009) The CD300 molecules regulate monocyte and dendritic cell functions. Immunobiology. 214(9-10):730-6.
  • Engel K, et al. (2012) Bacterial expression of mutant argininosuccinate lyase reveals imperfect correlation of in-vitro enzyme activity with clinical phenotype in argininosuccinic aciduria. J Inherit Metab Dis. 35(1):133-40.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Size / Price
    Cat No: HG13365-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".