Text Size:AAA

휴먼 CD40/TNFRSF5 transcript variant 2 Gene ORF cDNA clone expression plasmid

Human CD40 cDNA 클론 제품 정보
cDNA 크기:612bp
cDNA 설명:Full length Clone DNA of Homo sapiens CD40 molecule, TNF receptor superfamily member 5.
유전자 동의어: p50, Bp50, CDW40, TNFRSF5
제한 사이트:HindIII + XbaI (5.5kb + 0.61kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human CD40 Gene Plasmid Map
Human CD40 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
휴먼 CD40/TNFRSF5 transcript variant 2 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name

CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins. CD40 protein plays an essential role in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. CD40 protein is expressed in B cells, dendritic cells, macrophages, endothelial cells, and several tumor cell lines. Defects in CD40 result in hyper-IgM immunodeficiency type 3 (HIGM3). In addition, CD40/CD40L interaction is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis.

  • van Kooten C, et al. (2000). CD40-CD40 ligand. J Leukoc Biol. 67 (1): 2-17.
  • Bhushan A, et al. (2002). CD40:CD40L interactions in X-linked and non-X-linked hyper-IgM syndromes. Immunol Res. 24 (3): 311-24.
  • Chatzigeorgiou A, et al. (2009) CD40/CD40L signaling and its implication in health and disease. Biofactors. 35(6): 474-83.
  • Li R, et al. (2009) Expression of CD40 and CD40L in Gastric Cancer Tissue and Its Clinical Significance. Int J Mol Sci. 10(9): 3900-17.
  • Lievens D, et al. (2009) The multi-functionality of CD40L and its receptor CD40 in atherosclerosis. Thromb Haemost. 102(2): 206-14.
  • Size / Price
    Cat No: HG16492-G-N
    가격:      (You Save: )
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    • Human CD40 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".