After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human CDK1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001786.4
cDNA 크기:894bp
cDNA 설명:Full length Clone DNA of Homo sapiens cell division cycle 2, G1 to S and G2 to M transcript variant 1 with N terminal His tag.
유전자 동의어:CDK1, CDC28A, MGC111195, DKFZp686L20222, CDC2
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10739-ACG265260
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10739-ACR265260
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10739-ANG265260
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10739-ANR265260
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10739-CF229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG10739-CH229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10739-CM229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10739-CY229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10739-M88420
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10739-M-F229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10739-M-N229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10739-NF229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG10739-NH229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10739-NM229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10739-NY229890
휴먼 CDC2 Kinase / CDK1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10739-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

참고자료
  • Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.
  • Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.
  • Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.
  • Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.
  • Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.
  •  

    Size / Price
    Cat No: HG10739-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".