After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Cadherin-6/CDH6 Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Human CDH6 cDNA 클론 제품 정보
Gene_bank_ref_id:BC000019.2
cDNA 크기:1992bp
cDNA 설명:Full length Clone DNA of Homo sapiens cadherin 6, type 2, K-cadherin (fetal kidney) with N terminal Myc tag.
유전자 동의어:CDH6, KCAD
:Human
벡터:pCMV3-SP-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Cadherins are a family of calcium-dependent, cell-cell adhesion molecules that play an important morphoregulatory role in a wide variety of tissues. Alterations in cadherin function have been implicated in tumor progression in a number of adenocarcinomas. Cadherin-6 (CDH6), also known as K-cadherin (KCAD), is a type-II classic cadherin cell-cell adhesion molecules, which are expressed in graded or areal patterns, as well as layer-specific patterns, in the cortical plate. Human Cadherin-6 is synthesized as a 790 aa type I transmembrane glycoprotein that contains a 18 aa signal peptide, a 35 aa propeptide, a 562 aa extracellular region, a 21 aa transmembrane segment, and a 154 aa cytoplasmic domain. There are five cadherin domains of approximately 110 aa each in the extracellular region. Cadherin-6 is highly expressed in brain, cerebellum, and kidney, and may contribute to the formation of the segmental structure of the early brain, as well as the development of renal proximal tubules. Weak expression is also detected lung, pancreas, and gastric mucosa. Additionally, it is specifically expressed in the proximal tubule of normal kidneys and in renal cell cancer. Thus , Cadherin-6 is a new prognostic factor for renal cancer.

참고자료
  • Paul R, et al. (1997) Cadherin-6, a cell adhesion molecule specifically expressed in the proximal renal tubule and renal cell carcinoma. Cancer Res. 57(13): 2741-8.
  • Paul R, et al. (2004) Cadherin-6: a new prognostic marker for renal cell carcinoma. J Urol. 171(1): 97-101.
  • Taniguchi H, et al. (2006) Classic cadherins regulate tangential migration of precerebellar neurons in the caudal hindbrain. Development. 133(10): 1923-31.
  • Liu Q, et al. (2006) cadherin-6 message expression in the nervous system of developing zebrafish. Dev Dyn. 235(1): 272-8.
  • Size / Price
    Cat No: HG10150-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".