p21/WAF1/CDKN1A cDNA ORF Clone, Human, C-His tag

Cat: HG11108-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All p21/WAF1/CDKN1A Reagents

CRO Services

Product recommended


All p21/WAF1/CDKN1A Reagents

p21/WAF1/CDKN1A cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
495 bp
Description
Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1A (p21, Cip1) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p21/WAF1/CDKN1A cDNA ORF Clone, Human, C-His tag Alternative Names

CAP20 cDNA ORF Clone, Human;CDKN1 cDNA ORF Clone, Human;CIP1 cDNA ORF Clone, Human;MDA-6 cDNA ORF Clone, Human;P21 cDNA ORF Clone, Human;p21CIP1 cDNA ORF Clone, Human;SDI1 cDNA ORF Clone, Human;WAF1 cDNA ORF Clone, Human

p21/WAF1/CDKN1A Background Information

Full Name
cyclin-dependent kinase inhibitor 1A (p21, Cip1)

p21/WAF1/CDKN1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
p21/WAF1/CDKN1A cDNA ORF Clone in Cloning Vector, Rat RG81956-U
p21/WAF1/CDKN1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81956-ACGLN

p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
p21/WAF1/CDKN1A cDNA ORF Clone in Cloning Vector, Mouse MG52793-U
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, untagged MG52793-UT
p21/WAF1/CDKN1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52793-ACGLN
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52793-ACG
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52793-ANG
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52793-ACR
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52793-ANR
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52793-CF
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52793-NF
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, C-His tag MG52793-CH
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, N-His tag MG52793-NH
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, C-HA tag MG52793-CY
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, N-HA tag MG52793-NY
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, C-Myc tag MG52793-CM
p21/WAF1/CDKN1A cDNA ORF Clone, Mouse, N-Myc tag MG52793-NM

p21/WAF1/CDKN1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
p21/WAF1/CDKN1A cDNA ORF Clone in Cloning Vector, Human HG11108-M
p21/WAF1/CDKN1A cDNA ORF Clone, Human, untagged HG11108-UT
p21/WAF1/CDKN1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11108-ACGLN
p21/WAF1/CDKN1A cDNA ORF Clone, Human, C-GFPSpark® tag HG11108-ACG
p21/WAF1/CDKN1A cDNA ORF Clone, Human, N-GFPSpark® tag HG11108-ANG
p21/WAF1/CDKN1A cDNA ORF Clone, Human, C-OFPSpark® tag HG11108-ACR
p21/WAF1/CDKN1A cDNA ORF Clone, Human, N-OFPSpark® tag HG11108-ANR
p21/WAF1/CDKN1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11108-CF
p21/WAF1/CDKN1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11108-NF
p21/WAF1/CDKN1A cDNA ORF Clone, Human, N-His tag HG11108-NH
p21/WAF1/CDKN1A cDNA ORF Clone, Human, C-HA tag HG11108-CY
p21/WAF1/CDKN1A cDNA ORF Clone, Human, N-HA tag HG11108-NY
p21/WAF1/CDKN1A cDNA ORF Clone, Human, C-Myc tag HG11108-CM
p21/WAF1/CDKN1A cDNA ORF Clone, Human, N-Myc tag HG11108-NM
p21/WAF1/CDKN1A qPCR Primer Pairs, Human HP101023
info info
添加购物车成功! 添加购物车失败!