Text Size:AAA

휴먼 CGB7 Gene ORF cDNA clone expression plasmid, N-Myc 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 CGB7 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_033043.1
    cDNA 크기:498bp
    cDNA 설명:Full length Clone DNA of Homo sapiens chorionic gonadotropin, beta polypeptide 7 with N terminal Myc tag.
    유전자 동의어:FLJ35403, FLJ43118, CG-beta-a, CGB7
    :Human
    벡터:pCMV3-SP-N-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CGB7 qPCR primers for gene expression analysis, HP101741 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    연구배경

    CGB7 (chorionic gonadotropin, beta polypeptide 7) belongs to the glycoprotein hormones subunit beta family. Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CGB7 gene is a member of the glycoprotein hormone beta chain family and encodes the beta 7 subunit of chorionic gonadotropin (CG). CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. CGB7 is used as adjunctive therapy in the treatment of obesity. CGB7 also stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy.

    참고자료
  • Fiddes J.C., et al.,(1980), The cDNA for the beta-subunit of human chorionic gonadotropin suggests evolution of a gene by readthrough into the 3'-untranslated region. Nature 286:684-687.
  • Talmadge K., et al., (1984), Evolution of the genes for the beta subunits of human chorionic gonadotropin and luteinizing hormone.Nature 307:37-40.
  • Policastro P., et al.,(1983), The beta subunit of human chorionic gonadotropin is encoded by multiple genes.J. Biol. Chem. 258:11492-11499.
  • Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".