CGR19/CGRRF1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11444-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CGR19/CGRRF1 Reagents
CRO Services
Product recommended

All CGR19/CGRRF1 Reagents
CGR19/CGRRF1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
999 bp
Description
Full length Clone DNA of Human cell growth regulator with ring finger domain 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CGR19/CGRRF1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CGR19 cDNA ORF Clone, Human;RNF197 cDNA ORF Clone, Human
CGR19/CGRRF1 Background Information
Full Name
cell growth regulator with ring finger domain 1

CGR19/CGRRF1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
CGR19/CGRRF1 cDNA ORF Clone in Cloning Vector, Canine DG70161-U

CGR19/CGRRF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CGR19/CGRRF1 cDNA ORF Clone in Cloning Vector, Mouse MG54401-U
CGR19/CGRRF1 cDNA ORF Clone, Mouse, untagged MG54401-UT
CGR19/CGRRF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54401-ACG
CGR19/CGRRF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54401-ACGLN
CGR19/CGRRF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54401-ANG
CGR19/CGRRF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54401-ACR
CGR19/CGRRF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54401-ANR
CGR19/CGRRF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54401-CF
CGR19/CGRRF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54401-NF
CGR19/CGRRF1 cDNA ORF Clone, Mouse, C-His tag MG54401-CH
CGR19/CGRRF1 cDNA ORF Clone, Mouse, N-His tag MG54401-NH
CGR19/CGRRF1 cDNA ORF Clone, Mouse, C-HA tag MG54401-CY
CGR19/CGRRF1 cDNA ORF Clone, Mouse, N-HA tag MG54401-NY
CGR19/CGRRF1 cDNA ORF Clone, Mouse, C-Myc tag MG54401-CM
CGR19/CGRRF1 cDNA ORF Clone, Mouse, N-Myc tag MG54401-NM

CGR19/CGRRF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CGR19/CGRRF1 cDNA ORF Clone in Cloning Vector, Human HG11444-M
CGR19/CGRRF1 cDNA ORF Clone, Human, untagged HG11444-UT
CGR19/CGRRF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11444-ACGLN
CGR19/CGRRF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11444-ACG
CGR19/CGRRF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11444-ANG
CGR19/CGRRF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11444-ACR
CGR19/CGRRF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11444-ANR
CGR19/CGRRF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11444-CF
CGR19/CGRRF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11444-NF
CGR19/CGRRF1 cDNA ORF Clone, Human, C-His tag HG11444-CH
CGR19/CGRRF1 cDNA ORF Clone, Human, N-His tag HG11444-NH
CGR19/CGRRF1 cDNA ORF Clone, Human, C-HA tag HG11444-CY
CGR19/CGRRF1 cDNA ORF Clone, Human, N-HA tag HG11444-NY
CGR19/CGRRF1 cDNA ORF Clone, Human, C-Myc tag HG11444-CM
CGR19/CGRRF1 qPCR Primer Pairs, Human HP101321
info info
添加购物车成功! 添加购物车失败!