After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 CHL1/LICAM2/CALL Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Human CHL1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_006614.2
cDNA 크기:3675bp
cDNA 설명:Full length Clone DNA of Homo sapiens CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) with N terminal Myc tag.
유전자 동의어:CHL1, CALL, L1CAM2, FLJ44930, MGC132578
:Human
벡터:pCMV3-SP-N-Myc
Plasmid:
제한 사이트:HindIII + XhoI
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Neural cell adhesion molecule L1-like protein, also known as close homolog of L1 (CHL1) is the prototypic member of the CTF / NF-1 family of transcription factors that serve as a novel calcium signaling pathway-responsive transcription factor and is considered as a member of the largest ctf complementation group, consisting of 30 of 126 ctf mutants isolated. CHL1 is a cell adhesion molecule highly related to L1. It contains structure plan of six extracellular C2-type immunoglobulin (Ig) domains followed by five fibronectin typeⅢ domains linked by a single membrane-spanning region to a short cytoplasmic domain. The extracellular portion of CHL1 is higyly glycosylated and involved them in hemophilic disease.

참고자료
  • Alevizopoulos A, et al. (1997) Regulation of the Transforming Growth Factor beta-responsive Transcription Factor CTF-1 by Calcineurin and Calcium/ Calmodulin-dependent Protein Kinase IV. The Journal of Biological Chemistry. 272: 23597-605.
  • Gerring SL, et al. (1990) The CHL1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G2 / M. EMBO J. 9 (13): 4347-58.
  • Wei MH, et al. (1998) In silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Human Genetics. 103 (3): 355-64.
  • Size / Price
    Cat No: HG10143-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".