휴먼 CHST11 / C4ST-1 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 CHST11 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001173982.1
    cDNA 크기:1059bp
    cDNA 설명:Full length Clone DNA of Homo sapiens carbohydrate (chondroitin 4) sulfotransferase 11 with N terminal His tag.
    유전자 동의어:C4ST, C4ST1, C4ST-1, HSA269537, CHST11
    :Human
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CHST11 qPCR primers for gene expression analysis, HP101273 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    휴먼 CHST11 / C4ST-1 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
    Product nameProduct name
    연구배경

    CHST11, also known as C4ST-1, belongs to the sulfotransferase 2 family. CHST11 localizes to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. A chromosomal translocation involving CHST11 gene and IgH, t(12;14)(q23;q32), has been reported in a patient with B-cell chronic lymphocytic leukemia.

    참고자료
  • Hiraoka N. et al., 2000, J Biol Chem. 275 (26): 20188-96.
  • Schmidt HH. et al., 2004, Oncogene. 23 (41): 6991-6.
  • Okuda T. et al., 2001, J Biochem. 128 (5): 763-70.
  • Size / Price
    Cat No: HG11396-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".