CIAO1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14732-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CIAO1 Reagents

CRO Services

Product recommended


All CIAO1 Reagents

CIAO1 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1020 bp
Description
Full length Clone DNA of Human cytosolic iron-sulfur protein assembly 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CIAO1 cDNA ORF Clone, Human, C-Myc tag Alternative Names

CIA1 cDNA ORF Clone, Human;WDR39 cDNA ORF Clone, Human

CIAO1 Background Information

Full Name
cytosolic iron-sulfur assembly component 1

CIAO1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CIAO1 cDNA ORF Clone in Cloning Vector, Mouse MG52254-G
CIAO1 cDNA ORF Clone, Mouse, untagged MG52254-UT
CIAO1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52254-ACGLN
CIAO1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52254-ACG
CIAO1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52254-ANG
CIAO1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52254-ACR
CIAO1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52254-ANR
CIAO1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52254-CF
CIAO1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52254-NF
CIAO1 cDNA ORF Clone, Mouse, C-His tag MG52254-CH
CIAO1 cDNA ORF Clone, Mouse, N-His tag MG52254-NH
CIAO1 cDNA ORF Clone, Mouse, C-HA tag MG52254-CY
CIAO1 cDNA ORF Clone, Mouse, N-HA tag MG52254-NY
CIAO1 cDNA ORF Clone, Mouse, C-Myc tag MG52254-CM
CIAO1 cDNA ORF Clone, Mouse, N-Myc tag MG52254-NM
CIAO1 qPCR Primer Pairs, Mouse MP202127

CIAO1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CIAO1 cDNA ORF Clone in Cloning Vector, Human HG14732-G
CIAO1 cDNA ORF Clone, Human, untagged HG14732-UT
CIAO1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14732-ACGLN
CIAO1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14732-ACG
CIAO1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14732-ANG
CIAO1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14732-ACR
CIAO1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14732-ANR
CIAO1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14732-CF
CIAO1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14732-NF
CIAO1 cDNA ORF Clone, Human, C-His tag HG14732-CH
CIAO1 cDNA ORF Clone, Human, N-His tag HG14732-NH
CIAO1 cDNA ORF Clone, Human, C-HA tag HG14732-CY
CIAO1 cDNA ORF Clone, Human, N-HA tag HG14732-NY
CIAO1 cDNA ORF Clone, Human, N-Myc tag HG14732-NM
CIAO1 qPCR Primer Pairs, Human HP103365
info info
添加购物车成功! 添加购物车失败!