After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 Tetranectin/CLEC3B Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human CLEC3B cDNA 클론 제품 정보
Gene_bank_ref_id:BC011024.1
cDNA 크기:609bp
cDNA 설명:Full length Clone DNA of Homo sapiens C-type lectin domain family 3, member B with N terminal His tag.
유전자 동의어:TN, TNA, DKFZp686H17246, CLEC3B
:Human
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Tetranectin (TN), also known as C-type lectin domain family 3, member B (CLEC3B) is a member of the C-type lectin Family. It is plasminogen kringle 4 binding protein and regulates fibrinolysis and proteolytic processes via binding to plasminogen. Tetranectin has been suggested to play a role in tissue remodeling, due to its ability to stimulate plasminogen activation and its expression in developing tissues such as developing bone and muscle. Tetranectin enhances plasminogen activation by a tissue-type plasminogen activator so that it has been suggested to play a role in tissue remodeling. Tetranectin may play a role in the wound healing process. Tetranectin may play a role in neurological diseases and may serve as a diagnostic aid in multiple sclerosis (MS). Tetranectin was found significantly under-expressed in both serum and saliva of metastatic oral squamous cell carcinoma (OSCC) compared to primary OSCC. Tetranectin is thought to enhance proteolytic processes enabling tumor cells to invade and metastasize.

참고자료
  • Iba K, et al. (2001) Mice with a targeted deletion of the tetranectin gene exhibit a spinal deformity. Mol Cell Biol. 21(22): 7817-25.
  • Stoevring B, et al. (2006) Tetranectin in cerebrospinal fluid of patients with multiple sclerosis. Scand J Clin Lab Invest. 66(7): 577-83.
  • Brunner A, et al. (2007) Expression and prognostic significance of Tetranectin in invasive and non-invasive bladder cancer. Virchows Arch. 450(6): 659-64.
  • Iba K, et al. (2009) Impaired cutaneous wound healing in mice lacking tetranectin. Wound Repair Regen. 17(1): 108-12.
  • Arellano-Garcia ME, et al. (2010) Identification of tetranectin as a potential biomarker for metastatic oral cancer. Int J Mol Sci. 11(9): 3106-21.
  • Wang L, et al. (2010) Tetranectin is a potential biomarker in cerebrospinal fluid and serum of patients with epilepsy. Clin Chim Acta. 411(7-8): 581-3.
  • Size / Price
    Cat No: HG12735-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".