After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 DC-SIGNR/CD299 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human CLEC4M cDNA 클론 제품 정보
Gene_bank_ref_id:NM_014257.3
cDNA 크기:1200bp
cDNA 설명:Full length Clone DNA of Homo sapiens C-type lectin domain family 4, member M with N terminal Flag tag.
유전자 동의어:CD299, LSIGN, CD209L, L-SIGN, DCSIGNR, HP10347, DC-SIGN2, DC-SIGNR, MGC47866, MGC129964
:Human
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

C-type lectin domain family 4, member M, also known as DC-SIGNR and CLEC4M, is a type II integral membrane protein that is 77% amino acid identical to DC-SIGN, an HIV gp120-binding protein. Though the encoded gene located in the same chromosome, DC-SIGN is expressed solely on dendritic cells, while DC-SIGNR is predominantly found in liver sinusoidal endothelial cells and lymph node, as well as placental endothelium. DC-SIGNR exists as a homotetramer, and the tandem repeat domain, also called neck domain, mediates oligermerization. DC-SIGNR is ragarded as a pathogen-recognition receptor involved in peripheral immune surveillance in liver, and probably mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. DC-SIGNR appears to selectively recognize and bind many viral surface glycoproteins containing high mannose N-linked oligosaccharides in a calcium-dependent manner, including HIV-1 gp120, HIV-2 gp120, SIV gp120, ebolavirus glycoproteins, HCV E2, and human SARS coronavirus protein S, as well as the cellular adhesion protein ICAM3. DC-SIGNR have been thought to play an important role in establishing HIV infection by enhancing trans-infection of CD4(+)T cells in the regional lymph nodes. It may affect susceptibility to HIV infection by a mechanism that is different in females and males. DC-SIGNR can bind to hepatitis C virus (HCV), and its polymorphism might affect HCV loads supporting the concept that DC-SIGNR contributes to HCV replication efficacy.

참고자료
  • Nattermann J, et al. (2006) The tandem-repeat polymorphism of the DC-SIGNR gene in HCV infection. J Viral Hepat. 13(1): 42-6.
  • Wichukchinda N, et al. (2007) The polymorphisms in DC-SIGNR affect susceptibility to HIV type 1 infection. AIDS Res Hum Retroviruses. 23(5): 686-92.
  • Size / Price
    Cat No: HG10559-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".