휴먼 CLIC1/NCC27 Gene ORF cDNA clone expression plasmid

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
데이터시트리뷰관련제품프로토콜
휴먼 CLIC1 cDNA 클론 제품 정보
Gene_bank_ref_id:BC064527
cDNA 크기:726bp
cDNA 설명:Full length Clone DNA of Homo sapiens chloride intracellular channel 1 DNA.
유전자 동의어:G6, NCC27
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-CLIC1
제한 사이트:KpnI + XbaI(6.1kb+0.73kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CLIC1 qPCR primers for gene expression analysis, HP103868 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Cat No: HG15242-UT
정가: 
가격:      (You Save: )

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".