Text Size:AAA

휴먼 CMPK1 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
휴먼 CMPK1 cDNA 클론 제품 정보
Gene_bank_ref_id:BC014961
cDNA 크기:687bp
cDNA 설명:Full length Clone DNA of Homo sapiens cytidine monophosphate (UMP-CMP) kinase 1, cytosol with N terminal His tag.
유전자 동의어:RP11-511I2.1, CMK, CMPK, UMK, UMP-CMPK, UMPK, CMPK1
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CMPK1 qPCR primers for gene expression analysis, HP102908 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

CMPK1 plays a key role in the maintenance of pyrimidine nucleotide pool profile and for the metabolism of pyrimidine analogs in cells. It catalyzes the phosphoryl transfer from ATP to UMP, CMP, and deoxy-CMP (dCMP), resulting in the formation of ADP and the corresponding nucleoside diphosphate. CMPK1 also has a significant role in the activation of pyrimidine analogs, which are clinically useful anti-cancer and anti-viral drugs. In the meanwhile, CMPK1 functions in cellular nucleic acid biosynthesis.

참고자료
  • Liou J, et al. (2004) Phosphorylation of Cytidine, Deoxycytidine, and Their Analog Monophosphates by Human UMP/CMP Kinase is Differentially Regulated by ATP and Magnesium. Molecular Pharmacology. 67(3):806-14.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC). Genome Research. 14(10B):2121-7.
  • Segura-Pena D, et al. (2004) Substrate-induced Conformational Changes in Human UMP/CMP Kinase. Journal of Biological Chemistry. 279(32):33882-9.
  • Size / Price
    Cat No: HG14258-NH
    정가: 
    가격:      (You Save: )
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".