CNPY3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13328-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CNPY3 Reagents
CRO Services
Product recommended

All CNPY3 Reagents
CNPY3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
837 bp
Description
Full length Clone DNA of Human canopy 3 homolog (zebrafish) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CNPY3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CAG4A cDNA ORF Clone, Human;ERDA5 cDNA ORF Clone, Human;PRAT4A cDNA ORF Clone, Human;TNRC5 cDNA ORF Clone, Human
CNPY3 Background Information
Full Name
canopy FGF signaling regulator 3

CNPY3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CNPY3 cDNA ORF Clone in Cloning Vector, Mouse MG51146-G
CNPY3 cDNA ORF Clone, Mouse, untagged MG51146-UT
CNPY3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51146-ACGLN
CNPY3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51146-ACG
CNPY3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51146-ACR
CNPY3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51146-CF
CNPY3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51146-NF
CNPY3 cDNA ORF Clone, Mouse, C-His tag MG51146-CH
CNPY3 cDNA ORF Clone, Mouse, N-His tag MG51146-NH
CNPY3 cDNA ORF Clone, Mouse, C-HA tag MG51146-CY
CNPY3 cDNA ORF Clone, Mouse, N-HA tag MG51146-NY
CNPY3 cDNA ORF Clone, Mouse, C-Myc tag MG51146-CM
CNPY3 cDNA ORF Clone, Mouse, N-Myc tag MG51146-NM

CNPY3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CNPY3 cDNA ORF Clone in Cloning Vector, Human HG13328-G
CNPY3 cDNA ORF Clone, Human, untagged HG13328-UT
CNPY3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13328-ACGLN
CNPY3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13328-ACG
CNPY3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13328-ACR
CNPY3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13328-NF
CNPY3 cDNA ORF Clone, Human, C-His tag HG13328-CH
CNPY3 cDNA ORF Clone, Human, N-His tag HG13328-NH
CNPY3 cDNA ORF Clone, Human, C-HA tag HG13328-CY
CNPY3 cDNA ORF Clone, Human, N-HA tag HG13328-NY
CNPY3 cDNA ORF Clone, Human, C-Myc tag HG13328-CM
CNPY3 cDNA ORF Clone, Human, N-Myc tag HG13328-NM
CNPY3 qPCR Primer Pairs, Human HP102033
info info
添加购物车成功! 添加购物车失败!