After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 Contactin 3/CNTN3 Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Human CNTN3 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_020872.1
cDNA 크기:3087bp
cDNA 설명:Full length Clone DNA of Homo sapiens contactin 3 (plasmacytoma associated) with N terminal Myc tag.
유전자 동의어:CNTN3, PCS, PANG, BIG-1, KIAA1496
:Human
벡터:pCMV3-SP-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-3, also known as CNTN3 ( BIG-1 in rat and PANG in mouse ), is a GPI-linked glycoprotein that is expressed on cerebellar Purkinje cells, amygdaloid and thalamic neurons and olfactory granule cells. In the brain, Contactin-3 is expressed in frontal lobe, occipital lobe, cerebellum and amygdala. Contactin-3 contains 4 fibronectin type-III domains and 6 Ig-like C2-type (immunoglobulin-like) domains. Human Contactin-3 shares 92% aa identity with mouse Contactin-3.The exact function of Contactin-3 is unclear. Contactin-3 may mediate cell-cell interaction and may promote neurite outgrowth.

참고자료
  • Yoshihara Y, et al. (1994) BIG-1: a new TAG-1/F3-related member of the immunoglobulin superfamily with neurite outgrowth-promoting activity. Neuron 13(2):415-26.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.
  • Size / Price
    Cat No: HG10174-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".