Carboxypeptidase A2 cDNA ORF Clone, Human, N-HA tag

Cat: HG10499-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Carboxypeptidase A2 Reagents

CRO Services

Product recommended


All Carboxypeptidase A2 Reagents

Carboxypeptidase A2 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Description
Full length Clone DNA of Human carboxypeptidase A2 (pancreatic) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carboxypeptidase A2 cDNA ORF Clone, Human, N-HA tag Alternative Names

CPA2 cDNA ORF Clone, Human

Carboxypeptidase A2 Background Information

Carboxypeptidase A2 ( CPA2 ) is a secreted pancreatic procarboxy -peptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group. The hydrolytic action of CPA2 was identified with a preference towards long substrates with aromatic amino acids in their C-terminal end, particularly tryptophan. CPA2 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. Three different forms of human pancreatic procarboxypeptidase A have been isolated, and the A1 and A2 forms are always secreted as monomeric proteins with different biochemical properties.

Full Name
carboxypeptidase A2
References
  • Catasus, L. et al., 1995. J. Biol. Chem. 270: 6651-6657.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Laethem, RM. et al., 1996, Arch. Biochem. Biophys.332: 8-18.
  • Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase A2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90538-U
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, untagged CG90538-UT
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90538-ACG
    Carboxypeptidase A2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90538-ACGLN
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90538-ACR
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90538-CF
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90538-NF
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, C-His tag CG90538-CH
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, N-His tag CG90538-NH
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90538-CY
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90538-NY
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90538-CM
    Carboxypeptidase A2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90538-NM

    Carboxypeptidase A2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase A2 cDNA ORF Clone in Cloning Vector, Rat RG80715-U
    Carboxypeptidase A2 cDNA ORF Clone, Rat, untagged RG80715-UT
    Carboxypeptidase A2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80715-ACG
    Carboxypeptidase A2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80715-ACGLN
    Carboxypeptidase A2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80715-ACR
    Carboxypeptidase A2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80715-CF
    Carboxypeptidase A2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80715-NF
    Carboxypeptidase A2 cDNA ORF Clone, Rat, C-His tag RG80715-CH
    Carboxypeptidase A2 cDNA ORF Clone, Rat, N-His tag RG80715-NH
    Carboxypeptidase A2 cDNA ORF Clone, Rat, C-HA tag RG80715-CY
    Carboxypeptidase A2 cDNA ORF Clone, Rat, N-HA tag RG80715-NY
    Carboxypeptidase A2 cDNA ORF Clone, Rat, C-Myc tag RG80715-CM
    Carboxypeptidase A2 cDNA ORF Clone, Rat, N-Myc tag RG80715-NM
    Carboxypeptidase A2 qPCR Primer Pairs, Rat RP300679

    Carboxypeptidase A2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase A2 cDNA ORF Clone in Cloning Vector, Mouse MG50778-G
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, untagged MG50778-UT
    Carboxypeptidase A2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50778-ACGLN
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50778-ACG
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50778-ACR
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50778-CF
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50778-NF
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, C-His tag MG50778-CH
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, N-His tag MG50778-NH
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, C-HA tag MG50778-CY
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, N-HA tag MG50778-NY
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, C-Myc tag MG50778-CM
    Carboxypeptidase A2 cDNA ORF Clone, Mouse, N-Myc tag MG50778-NM
    Carboxypeptidase A2 qPCR Primer Pairs, Mouse MP200752

    Carboxypeptidase A2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase A2 cDNA ORF Clone in Cloning Vector, Human HG10499-M
    Carboxypeptidase A2 cDNA ORF Clone, Human, untagged HG10499-UT
    Carboxypeptidase A2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10499-ACG
    Carboxypeptidase A2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10499-ACGLN
    Carboxypeptidase A2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10499-ACR
    Carboxypeptidase A2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10499-CF
    Carboxypeptidase A2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10499-NF
    Carboxypeptidase A2 cDNA ORF Clone, Human, C-His tag HG10499-CH
    Carboxypeptidase A2 cDNA ORF Clone, Human, N-His tag HG10499-NH
    Carboxypeptidase A2 cDNA ORF Clone, Human, C-HA tag HG10499-CY
    Carboxypeptidase A2 cDNA ORF Clone, Human, C-Myc tag HG10499-CM
    Carboxypeptidase A2 cDNA ORF Clone, Human, N-Myc tag HG10499-NM
    Carboxypeptidase A2 qPCR Primer Pairs, Human HP100520
    info info
    添加购物车成功! 添加购物车失败!