After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human CRIPT cDNA 클론 제품 정보
Gene_bank_ref_id:BC006980
cDNA 크기:306bp
cDNA 설명:Full length Clone DNA of Homo sapiens cysteine-rich PDZ-binding protein with N terminal Flag tag.
유전자 동의어:HSPC139
:Human
벡터:pCMV3-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG14560-ACG265260
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG14560-ACR265260
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG14560-ANG265260
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG14560-ANR265260
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG14560-CF229890
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, C-His 태그HG14560-CH229890
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG14560-CM229890
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, C-HA 태그HG14560-CY229890
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone in cloning vectorHG14560-G88420
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG14560-NF229890
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, N-His 태그HG14560-NH229890
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG14560-NM229890
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmid, N-HA 태그HG14560-NY229890
휴먼 CRIPT / cysteine-rich PDZ-binding 단백질 Gene ORF cDNA clone expression plasmidHG14560-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also interacts strongly with the PDZ3 domain of members of the DLG4 family. It is involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. CRIPT is highly conserved from mammals to plants and binds selectively to the third PDZ domain (PDZ3) of PSD-95 via its C terminus. n heterologous cells, CRIPT causes a redistribution of PSD-95 to microtubules. In brain, CRIPT colocalizes with PSD-95 in the postsynaptic density and can be coimmunoprecipitated with PSD-95 and tubulin. These findings suggest that CRIPT may regulate PSD-95 interaction with a tubulin-based cytoskeleton in excitatory synapses.

참고자료
  • Niethammer M. et al., 1998,Neuron. 20 (4): 693-707.
  • Passafaro M. et al., 2000, Nat Neurosci. 2 (12): 1063-9.
  • Piserchio A. et al., 2002, J Biol Chem. 277 (9): 6967-73.
  • Fukunaga Y. et al., 2005, J Biochem. 138 (2): 177-82.
  • Size / Price
    Cat No: HG14560-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".