CRIPT cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14560-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CRIPT Reagents

CRO Services

Product recommended


All CRIPT Reagents

CRIPT cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
306 bp
Description
Full length Clone DNA of Human cysteine-rich PDZ-binding protein with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRIPT cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

HSPC139 cDNA ORF Clone, Human;SSMDF cDNA ORF Clone, Human

CRIPT Background Information

CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also interacts strongly with the PDZ3 domain of members of the DLG4 family. It is involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. CRIPT is highly conserved from mammals to plants and binds selectively to the third PDZ domain (PDZ3) of PSD-95 via its C terminus. n heterologous cells, CRIPT causes a redistribution of PSD-95 to microtubules. In brain, CRIPT colocalizes with PSD-95 in the postsynaptic density and can be coimmunoprecipitated with PSD-95 and tubulin. These findings suggest that CRIPT may regulate PSD-95 interaction with a tubulin-based cytoskeleton in excitatory synapses.

Full Name
cysteine-rich PDZ-binding protein
References
  • Niethammer M. et al., 1998,Neuron. 20 (4): 693-707.
  • Passafaro M. et al., 2000, Nat Neurosci. 2 (12): 1063-9.
  • Piserchio A. et al., 2002, J Biol Chem. 277 (9): 6967-73.
  • Fukunaga Y. et al., 2005, J Biochem. 138 (2): 177-82.
  • CRIPT cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CRIPT cDNA ORF Clone in Cloning Vector, Mouse MG52570-G
    CRIPT cDNA ORF Clone, Mouse, untagged MG52570-UT
    CRIPT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52570-ACGLN
    CRIPT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52570-ACG
    CRIPT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52570-ANG
    CRIPT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52570-ACR
    CRIPT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52570-ANR
    CRIPT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52570-CF
    CRIPT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52570-NF
    CRIPT cDNA ORF Clone, Mouse, C-His tag MG52570-CH
    CRIPT cDNA ORF Clone, Mouse, N-His tag MG52570-NH
    CRIPT cDNA ORF Clone, Mouse, C-HA tag MG52570-CY
    CRIPT cDNA ORF Clone, Mouse, N-HA tag MG52570-NY
    CRIPT cDNA ORF Clone, Mouse, C-Myc tag MG52570-CM
    CRIPT cDNA ORF Clone, Mouse, N-Myc tag MG52570-NM
    CRIPT qPCR Primer Pairs, Mouse MP202442

    CRIPT cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CRIPT cDNA ORF Clone in Cloning Vector, Human HG14560-G
    CRIPT cDNA ORF Clone, Human, untagged HG14560-UT
    CRIPT cDNA ORF Clone, Human, C-GFPSpark® tag HG14560-ACG
    CRIPT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14560-ACGLN
    CRIPT cDNA ORF Clone, Human, N-GFPSpark® tag HG14560-ANG
    CRIPT cDNA ORF Clone, Human, C-OFPSpark® tag HG14560-ACR
    CRIPT cDNA ORF Clone, Human, N-OFPSpark® tag HG14560-ANR
    CRIPT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14560-CF
    CRIPT cDNA ORF Clone, Human, C-His tag HG14560-CH
    CRIPT cDNA ORF Clone, Human, N-His tag HG14560-NH
    CRIPT cDNA ORF Clone, Human, C-HA tag HG14560-CY
    CRIPT cDNA ORF Clone, Human, N-HA tag HG14560-NY
    CRIPT cDNA ORF Clone, Human, C-Myc tag HG14560-CM
    CRIPT cDNA ORF Clone, Human, N-Myc tag HG14560-NM
    CRIPT qPCR Primer Pairs, Human HP103205
    info info
    添加购物车成功! 添加购物车失败!