After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human CSNK1A1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001892.4
cDNA 크기:1014bp
cDNA 설명:Full length Clone DNA of Homo sapiens casein kinase 1, alpha 1.
유전자 동의어:CK1, HLCDGP1, PRO2975, CSNK1A1
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-CSNK1A1
제한 사이트:KpnI + XbaI (6.1kb + 1.01kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human CSNK1A1 Gene Plasmid Map
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid on other vectors
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10668-ACG265260
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10668-ACR265260
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10668-ANG265260
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10668-ANR265260
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10668-CF229890
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG10668-CH229890
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10668-CM229890
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10668-CY229890
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone in cloning vectorHG10668-M88420
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10668-M-F229890
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10668-NF229890
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG10668-NH229890
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10668-NM229890
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10668-NY229890
휴먼 CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmidHG10668-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

참고자료
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    Cat No: HG10668-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".